Sequence retrieval

Genome: Mycobacterium canettii CIPT 140010059
Start position: 935866
End position: 935892
Length: 27

DNA sequence
>NC_015848, from 935866 to 935892 (27 bp); Mycobacterium canettii CIPT 140010059 TCGCCGCCGTCGCCGCCGTCGCCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 935638-938283	Sequence	MCAN_08361 PE_PGRS14 PE-PGRS family protein (Protein is coded in complementary strand; from 938283 to 935638)