Sequence retrieval

Genome: Mycobacterium canettii CIPT 140010059
Start position: 694018
End position: 694062
Length: 45

DNA sequence
>NC_015848, from 694018 to 694062 (45 bp); Mycobacterium canettii CIPT 140010059 GGTGGTTGCCGACGTAGTCGTTGTCGACGTCGTGGTTGGCGACGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 693482-694156	Sequence	MCAN_05891 lpqN putative lipoprotein LPQN (Protein is coded in complementary strand; from 694156 to 693482)