Sequence retrieval

Genome: Mycobacterium canettii CIPT 140010059
Start position: 480617
End position: 480643
Length: 27

DNA sequence
>NC_015848, from 480617 to 480643 (27 bp); Mycobacterium canettii CIPT 140010059 TGCTCGGCGTGCTCGGCCTGTTCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 480602-482014	Sequence	MCAN_03941 ndhA putative membrane NADH dehydrogenase NDHA (Protein is coded in complementary strand; from 482014 to 480602)