Sequence retrieval

Genome: Mycobacterium canettii CIPT 140010059
Start position: 441782
End position: 441826
Length: 45

DNA sequence
>NC_015848, from 441782 to 441826 (45 bp); Mycobacterium canettii CIPT 140010059 CCGATGTTGGAGCTGCCGATGTTGCCGCTGCCGATGTTGCCGTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 431972-442495	Sequence	MCAN_03561 PPE8 PPE family protein (Protein is coded in complementary strand; from 442495 to 431972)