Sequence retrieval

Genome: Mycobacterium canettii CIPT 140010059
Start position: 4230003
End position: 4230029
Length: 27

DNA sequence
>NC_015848, from 4230003 to 4230029 (27 bp); Mycobacterium canettii CIPT 140010059 ACCCGGCATACCCGGCATACCCGGCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4229971-4230372	Sequence	MCAN_37381 - hypothetical protein (Protein is coded in complementary strand; from 4230372 to 4229971)