Sequence retrieval

Genome: Mycobacterium canettii CIPT 140010059
Start position: 4221219
End position: 4221245
Length: 27

DNA sequence
>NC_015848, from 4221219 to 4221245 (27 bp); Mycobacterium canettii CIPT 140010059 CTCGGCCAGCTCGGCCACCCCGGCCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4220698-4221735	Sequence	MCAN_37301 asd aspartate-semialdehyde dehydrogenase ASD (Protein is coded in complementary strand; from 4221735 to 4220698)