Sequence retrieval

Genome: Mycobacterium canettii CIPT 140010059
Start position: 4213292
End position: 4213315
Length: 24

DNA sequence
>NC_015848, from 4213292 to 4213315 (24 bp); Mycobacterium canettii CIPT 140010059 CCGCGGCGGCGGCCTCGGCCGCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4212322-4213473	Sequence	MCAN_37211 - aminotransferase, class V (Protein is coded in complementary strand; from 4213473 to 4212322)