Sequence retrieval

Genome: Mycobacterium canettii CIPT 140010059
Start position: 417782
End position: 417805
Length: 24

DNA sequence
>NC_015848, from 417782 to 417805 (24 bp); Mycobacterium canettii CIPT 140010059 CGTTGGCGCTGGCGTCGGCGCTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 417139-418578	Sequence	MCAN_03431 iniB isoniazid inductible gene protein INIB