Sequence retrieval

Genome: Mycobacterium canettii CIPT 140010059
Start position: 3977223
End position: 3977246
Length: 24

DNA sequence
>NC_015848, from 3977223 to 3977246 (24 bp); Mycobacterium canettii CIPT 140010059 CCCGACCGCGACCCCGACCCCAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3977125-3977967	Sequence	MCAN_35141 yrbE4B hypothetical protein (Protein is coded in complementary strand; from 3977967 to 3977125)