Sequence retrieval

Genome: Mycobacterium canettii CIPT 140010059
Start position: 3936094
End position: 3936129
Length: 36

DNA sequence
>NC_015848, from 3936094 to 3936129 (36 bp); Mycobacterium canettii CIPT 140010059 TCGGGGGCCTCTGCGGGGGGCTCTTCGGGGGCCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3936088-3936630	Sequence	MCAN_34731 rplQ putative 50S ribosomal protein L17 RPLQ (Protein is coded in complementary strand; from 3936630 to 3936088)