Sequence retrieval

Genome: Mycobacterium canettii CIPT 140010059
Start position: 3917917
End position: 3917943
Length: 27

DNA sequence
>NC_015848, from 3917917 to 3917943 (27 bp); Mycobacterium canettii CIPT 140010059 GGCAAGCCCGGCAAGCCCGGCAAACCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3917462-3918862	Sequence	MCAN_34561 - hypothetical protein (Protein is coded in complementary strand; from 3918862 to 3917462)