Sequence retrieval

Genome: Mycobacterium canettii CIPT 140010059
Start position: 3837825
End position: 3837849
Length: 25

DNA sequence
>NC_015848, from 3837825 to 3837849 (25 bp); Mycobacterium canettii CIPT 140010059 GCCGCGCCGGACCGCGCCGGGCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3837066-3837860	Sequence	MCAN_33771 - hypothetical protein (Protein is coded in complementary strand; from 3837860 to 3837066)