Sequence retrieval

Genome: Mycobacterium canettii CIPT 140010059
Start position: 3830793
End position: 3830837
Length: 45

DNA sequence
>NC_015848, from 3830793 to 3830837 (45 bp); Mycobacterium canettii CIPT 140010059 TTGCCGAACCCGAGGTTGCCGGTCCCGACGTTGCCGAGGCCCAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3825663-3836822	Sequence	MCAN_33761 PPE56 PPE family protein (Protein is coded in complementary strand; from 3836822 to 3825663)