Sequence retrieval

Genome: Mycobacterium canettii CIPT 140010059
Start position: 3806384
End position: 3806410
Length: 27

DNA sequence
>NC_015848, from 3806384 to 3806410 (27 bp); Mycobacterium canettii CIPT 140010059 GTTGCCGCCGTTGCCGCCGTTGCCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3804729-3810755	Sequence	MCAN_33711 PE_PGRS50 pe_pgrs50 protein (Protein is coded in complementary strand; from 3810755 to 3804729)