Sequence retrieval

Genome: Mycobacterium canettii CIPT 140010059
Start position: 3583355
End position: 3583399
Length: 45

DNA sequence
>NC_015848, from 3583355 to 3583399 (45 bp); Mycobacterium canettii CIPT 140010059 GTTTCCACTGCCCAGGTTCCCACTGCCAAAGTTTCCGTTGCCGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3582426-3584198	Sequence	MCAN_31731 PPE53 PPE family protein (Protein is coded in complementary strand; from 3584198 to 3582426)