Sequence retrieval

Genome: Mycobacterium canettii CIPT 140010059
Start position: 3508318
End position: 3508341
Length: 24

DNA sequence
>NC_015848, from 3508318 to 3508341 (24 bp); Mycobacterium canettii CIPT 140010059 CCGCCCACCCGCCAACACGCCCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3505280-3508612	Sequence	MCAN_31061 pknK putative serine/threonine-protein kinase transcriptional regulatory protein PKNK (protein kinase K) (STPK K) (Protein is coded in complementary strand; from 3508612 to 3505280)