Sequence retrieval

Genome: Mycobacterium canettii CIPT 140010059
Start position: 346499
End position: 346525
Length: 27

DNA sequence
>NC_015848, from 346499 to 346525 (27 bp); Mycobacterium canettii CIPT 140010059 CTCCGCCGTCTCCGCCGTCTCCGCCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 345607-348117	Sequence	MCAN_02871 - PE-PGRS family protein (Protein is coded in complementary strand; from 348117 to 345607)