Sequence retrieval

Genome: Mycobacterium canettii CIPT 140010059
Start position: 3120780
End position: 3120806
Length: 27

DNA sequence
>NC_015848, from 3120780 to 3120806 (27 bp); Mycobacterium canettii CIPT 140010059 TCGAAGTCCGCGAAGTCCTCGAAGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3119085-3121736	Sequence	MCAN_27751 ftsK putative cell division transmembrane protein FTSK (Protein is coded in complementary strand; from 3121736 to 3119085)