Sequence retrieval

Genome: Mycobacterium canettii CIPT 140010059
Start position: 3014041
End position: 3014076
Length: 36

DNA sequence
>NC_015848, from 3014041 to 3014076 (36 bp); Mycobacterium canettii CIPT 140010059 GCCGCCGTTCCCGCCGTTCCCGCCGTTGCCGCCGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3013295-3014518	Sequence	MCAN_26591 PE_PGRS45 PE-PGRS family protein (Protein is coded in complementary strand; from 3014518 to 3013295)