Sequence retrieval

Genome: Mycobacterium canettii CIPT 140010059
Start position: 2972656
End position: 2972679
Length: 24

DNA sequence
>NC_015848, from 2972656 to 2972679 (24 bp); Mycobacterium canettii CIPT 140010059 CGACACCGCCACCGACACCGGCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2972195-2973217	Sequence	MCAN_26201 - hypothetical protein (Protein is coded in complementary strand; from 2973217 to 2972195)