Sequence retrieval

Genome: Mycobacterium canettii CIPT 140010059
Start position: 2871199
End position: 2871225
Length: 27

DNA sequence
>NC_015848, from 2871199 to 2871225 (27 bp); Mycobacterium canettii CIPT 140010059 CCACCGGCACCACCGGCACCACCGGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2869315-2874297	Sequence	MCAN_25291 PE_PGRS43 PE-PGRS family protein (Protein is coded in complementary strand; from 2874297 to 2869315)