Sequence retrieval

Genome: Mycobacterium canettii CIPT 140010059
Start position: 2860288
End position: 2860314
Length: 27

DNA sequence
>NC_015848, from 2860288 to 2860314 (27 bp); Mycobacterium canettii CIPT 140010059 CCGCCGTCGCCGCCGTTGCCGCCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2859145-2861229	Sequence	MCAN_25251 PE_PGRS42 PE-PGRS family protein (Protein is coded in complementary strand; from 2861229 to 2859145)