Sequence retrieval

Genome: Mycobacterium canettii CIPT 140010059
Start position: 2830828
End position: 2830851
Length: 24

DNA sequence
>NC_015848, from 2830828 to 2830851 (24 bp); Mycobacterium canettii CIPT 140010059 GACCGGCGCACCGGCGAACCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2830091-2830897	Sequence	MCAN_25031 - putative DNA glycosylase (Protein is coded in complementary strand; from 2830897 to 2830091)