Sequence retrieval

Genome: Mycobacterium canettii CIPT 140010059
Start position: 2697292
End position: 2697336
Length: 45

DNA sequence
>NC_015848, from 2697292 to 2697336 (45 bp); Mycobacterium canettii CIPT 140010059 GGCTGCCGATATTTCCGCTGCCGAAGTTTCCGCTGCCGAAGTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2696301-2698148	Sequence	MCAN_23881 PPE40 PPE family protein (Protein is coded in complementary strand; from 2698148 to 2696301)