Sequence retrieval

Genome: Mycobacterium canettii CIPT 140010059
Start position: 2661260
End position: 2661286
Length: 27

DNA sequence
>NC_015848, from 2661260 to 2661286 (27 bp); Mycobacterium canettii CIPT 140010059 CAGTGCCAACAGTGCCAACAGTGCCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2660799-2661326	Sequence	MCAN_23611 lppP putative lipoprotein LPPP (Protein is coded in complementary strand; from 2661326 to 2660799)