Sequence retrieval

Genome: Mycobacterium canettii CIPT 140010059
Start position: 2654430
End position: 2654453
Length: 24

DNA sequence
>NC_015848, from 2654430 to 2654453 (24 bp); Mycobacterium canettii CIPT 140010059 CAGCGCGAGCGCCAACGCCACCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2654113-2654961	Sequence	MCAN_23561 - hypothetical protein (Protein is coded in complementary strand; from 2654961 to 2654113)