Sequence retrieval

Genome: Mycobacterium canettii CIPT 140010059
Start position: 2564923
End position: 2564952
Length: 30

DNA sequence
>NC_015848, from 2564923 to 2564952 (30 bp); Mycobacterium canettii CIPT 140010059 CGCCGAAGCCGACACCGACGCGGACACCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2564534-2565331	Sequence	MCAN_22621 - hypothetical protein (Protein is coded in complementary strand; from 2565331 to 2564534)