Sequence retrieval

Genome: Mycobacterium canettii CIPT 140010059
Start position: 2477848
End position: 2477874
Length: 27

DNA sequence
>NC_015848, from 2477848 to 2477874 (27 bp); Mycobacterium canettii CIPT 140010059 CCACCGGCCCCACCGGCGCCGCCGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2477287-2478867	Sequence	MCAN_21861 PE_PGRS38 PE-PGRS family protein (Protein is coded in complementary strand; from 2478867 to 2477287)