Sequence retrieval

Genome: Mycobacterium canettii CIPT 140010059
Start position: 2468544
End position: 2468567
Length: 24

DNA sequence
>NC_015848, from 2468544 to 2468567 (24 bp); Mycobacterium canettii CIPT 140010059 CCGGCACCAGCACCAGCACCAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2467391-2468965	Sequence	MCAN_21781 ftsW FtsW-like protein FtsW (Protein is coded in complementary strand; from 2468965 to 2467391)