Sequence retrieval

Genome: Mycobacterium canettii CIPT 140010059
Start position: 2441441
End position: 2441467
Length: 27

DNA sequence
>NC_015848, from 2441441 to 2441467 (27 bp); Mycobacterium canettii CIPT 140010059 CCCGCCGGCGCCGCCGGCCCCGCCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2441067-2441837	Sequence	MCAN_21501 PE_PGRS37 PE-PGRS family protein (Protein is coded in complementary strand; from 2441837 to 2441067)