Sequence retrieval

Genome: Mycobacterium canettii CIPT 140010059
Start position: 2352793
End position: 2352816
Length: 24

DNA sequence
>NC_015848, from 2352793 to 2352816 (24 bp); Mycobacterium canettii CIPT 140010059 TCGCCAACGCCATCGCGATCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2344305-2356769	Sequence	MCAN_20711 pks12 putative polyketide synthase pks12 (Protein is coded in complementary strand; from 2356769 to 2344305)