Sequence retrieval

Genome: Mycobacterium canettii CIPT 140010059
Start position: 2127138
End position: 2127164
Length: 27

DNA sequence
>NC_015848, from 2127138 to 2127164 (27 bp); Mycobacterium canettii CIPT 140010059 CCGCCGTTGCCGCCGTTGCCGCCGTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2126490-2128037	Sequence	MCAN_18551 PE_PGRS34 PE-PGRS family protein (Protein is coded in complementary strand; from 2128037 to 2126490)