Sequence retrieval

Genome: Mycobacterium canettii CIPT 140010059
Start position: 2018916
End position: 2018960
Length: 45

DNA sequence
>NC_015848, from 2018916 to 2018960 (45 bp); Mycobacterium canettii CIPT 140010059 GTGTTGCCAAAGCCGAAGTTGCCCAAGCCGGTGTTGGCAAACCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2015871-2019797	Sequence	MCAN_17671 - ppe family protein (Protein is coded in complementary strand; from 2019797 to 2015871)