Sequence retrieval

Genome: Mycobacterium canettii CIPT 140010059
Start position: 1891087
End position: 1891113
Length: 27

DNA sequence
>NC_015848, from 1891087 to 1891113 (27 bp); Mycobacterium canettii CIPT 140010059 CGGCGCCGCCGTCGCCGCCGGCACCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1889076-1892132	Sequence	MCAN_16601 PE_PGRS30 PE-PGRS family protein (Protein is coded in complementary strand; from 1892132 to 1889076)