Sequence retrieval

Genome: Mycobacterium canettii CIPT 140010059
Start position: 1815081
End position: 1815104
Length: 24

DNA sequence
>NC_015848, from 1815081 to 1815104 (24 bp); Mycobacterium canettii CIPT 140010059 TCGTCGTCGTTGTCCTCGTCGTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1815075-1815917	Sequence	MCAN_15951 - rep13e12 repeat protein (Protein is coded in complementary strand; from 1815917 to 1815075)