Sequence retrieval

Genome: Mycobacterium canettii CIPT 140010059
Start position: 1809858
End position: 1809902
Length: 45

DNA sequence
>NC_015848, from 1809858 to 1809902 (45 bp); Mycobacterium canettii CIPT 140010059 CGGCTGGACGGGCGCTTGCTGGACGGGCGCTTGCTGGACCGGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1809850-1810506	Sequence	MCAN_15891 - putative inv protein (Protein is coded in complementary strand; from 1810506 to 1809850)