Sequence retrieval

Genome: Mycobacterium canettii CIPT 140010059
Start position: 1679889
End position: 1679915
Length: 27

DNA sequence
>NC_015848, from 1679889 to 1679915 (27 bp); Mycobacterium canettii CIPT 140010059 CGTTGCCACCGTTGCCGCCGTTGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1679777-1680889	Sequence	MCAN_14841 PE_PGRS29 PE-PGRS family protein (Protein is coded in complementary strand; from 1680889 to 1679777)