Sequence retrieval

Genome: Mycobacterium canettii CIPT 140010059
Start position: 1660308
End position: 1660334
Length: 27

DNA sequence
>NC_015848, from 1660308 to 1660334 (27 bp); Mycobacterium canettii CIPT 140010059 GCCGCCGTTGCCGCCGTTGCCGCCGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1659310-1662330	Sequence	MCAN_14681 PE_PGRS28 PE-PGRS family protein (Protein is coded in complementary strand; from 1662330 to 1659310)