Sequence retrieval

Genome: Mycobacterium canettii CIPT 140010059
Start position: 1641473
End position: 1641499
Length: 27

DNA sequence
>NC_015848, from 1641473 to 1641499 (27 bp); Mycobacterium canettii CIPT 140010059 CGCCGTTGCCGCCGTTGCCGCCGTTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1641277-1642752	Sequence	MCAN_14571 PE_PGRS26 PE-PGRS family protein (Protein is coded in complementary strand; from 1642752 to 1641277)