Sequence retrieval

Genome: Mycobacterium canettii CIPT 140010059
Start position: 1507912
End position: 1507935
Length: 24

DNA sequence
>NC_015848, from 1507912 to 1507935 (24 bp); Mycobacterium canettii CIPT 140010059 TCGCGTACGCGTTCGCGCTCGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1507204-1508907	Sequence	MCAN_13371 - putative adenylate cyclase (Protein is coded in complementary strand; from 1508907 to 1507204)