Sequence retrieval

Genome: Mycobacterium canettii CIPT 140010059
Start position: 1405378
End position: 1405404
Length: 27

DNA sequence
>NC_015848, from 1405378 to 1405404 (27 bp); Mycobacterium canettii CIPT 140010059 CCGCCGTTGCCGCCGTTGCCGCCGCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1405081-1406769	Sequence	MCAN_12571 PE_PGRS23 PE-PGRS family protein (Protein is coded in complementary strand; from 1406769 to 1405081)