Sequence retrieval

Genome: Mycobacterium canettii CIPT 140010059
Start position: 1399266
End position: 1399289
Length: 24

DNA sequence
>NC_015848, from 1399266 to 1399289 (24 bp); Mycobacterium canettii CIPT 140010059 GGCGCTGGCGGTGACGCTGGCGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1399019-1399942	Sequence	MCAN_12501 sugA putative sugar-transport integral membrane protein ABC transporter SUGA