Sequence retrieval

Genome: Mycobacterium canettii CIPT 140010059
Start position: 1205993
End position: 1206019
Length: 27

DNA sequence
>NC_015848, from 1205993 to 1206019 (27 bp); Mycobacterium canettii CIPT 140010059 CCGTTGCCGCCGTTGCCGGCGTTGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1205087-1207390	Sequence	MCAN_10741 PE_PGRS20 PE-PGRS family protein (Protein is coded in complementary strand; from 1207390 to 1205087)