Sequence retrieval

Genome: Mycobacterium canettii CIPT 140010059
Start position: 1202883
End position: 1202909
Length: 27

DNA sequence
>NC_015848, from 1202883 to 1202909 (27 bp); Mycobacterium canettii CIPT 140010059 TTGCCGCCGTTGCCGCCGTTGCCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1202733-1204754	Sequence	MCAN_10731 PE_PGRS19 PE-PGRS family protein (Protein is coded in complementary strand; from 1204754 to 1202733)