Sequence retrieval

Genome: Mycobacterium canettii CIPT 140010059
Start position: 1119051
End position: 1119077
Length: 27

DNA sequence
>NC_015848, from 1119051 to 1119077 (27 bp); Mycobacterium canettii CIPT 140010059 CCAGAACTCCCCGAACTCCCCGAACTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1118979-1119311	Sequence	MCAN_09961 - hypothetical protein (Protein is coded in complementary strand; from 1119311 to 1118979)