Sequence retrieval

Genome: Mycobacterium canettii CIPT 140010059
Start position: 1087454
End position: 1087480
Length: 27

DNA sequence
>NC_015848, from 1087454 to 1087480 (27 bp); Mycobacterium canettii CIPT 140010059 TTTGCGCGGTTTGCGTGGTTTGCGGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1087452-1088063	Sequence	MCAN_09701 - hypothetical protein (Protein is coded in complementary strand; from 1088063 to 1087452)