Sequence retrieval

Genome: Mycobacterium canettii CIPT 140010059
Start position: 1011777
End position: 1011809
Length: 33

DNA sequence
>NC_015848, from 1011777 to 1011809 (33 bp); Mycobacterium canettii CIPT 140010059 TGCTCGCGGGGTGCGCGCGGGTTAGTCGCGGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1011799-1013286	Sequence	MCAN_09041 accD3 putative acetyl-coenzyme A carboxylase carboxyl transferase subunit beta ACCD3 (Protein is coded in complementary strand; from 1013286 to 1011799)