Sequence retrieval

Genome: Cupriavidus necator N-1
Start position: 2835993
End position: 2836052
Length: 60

DNA sequence
>NC_015726, from 2835993 to 2836052 (60 bp); Cupriavidus necator N-1 GTTCCGCTTCCCTGCGCTCGGCTTCCTTGCGTTCCGCCTCTTTGCGCTCGGCTTCCTTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2835362-2836420	Sequence	CNE_1c27340 - TonB-dependent outer membrane receptor (Protein is coded in complementary strand; from 2836420 to 2835362)