Sequence retrieval

Genome: Cupriavidus necator N-1
Start position: 3511356
End position: 3511409
Length: 54

DNA sequence
>NC_015726, from 3511356 to 3511409 (54 bp); Cupriavidus necator N-1 CGCGGGCGTAGCGGGCGTAGCGGGCGTAGCGGGCGTAGCGGGCGTAGCGGGCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3511177-3512202	Sequence	CNE_1c33650 vacJ surface lipoprotein, VacJ-like protein (Protein is coded in complementary strand; from 3512202 to 3511177)