Sequence retrieval

Genome: Cupriavidus necator N-1
Start position: 2619664
End position: 2619711
Length: 48

DNA sequence
>NC_015726, from 2619664 to 2619711 (48 bp); Cupriavidus necator N-1 ATGCTGCTGTGCTGCTGTGCTGCTGTGCTGCTGTGCTGCTGTGCTGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2619151-2619744	Sequence	CNE_1c25310 - hypothetical protein
ORF... 2619681-2620151	Sequence	CNE_1c25320 - hypothetical protein